Is the Use of the Death Penalty Justice and Is It Fair Essay

It is fair to say that capital punishment is under attack, particularly in the South where it is most commonly practiced. Not only have serious criticisms been raised by scholars in criminal justice, criminology and related disciplines, but newspapers have published scathing news reports suggesting that innocent people have been sentenced to death and even executed, and alleging racial discrimination in capital punishment practice. According to Robinson (2011), four basic facts establish the realities of American capital punishment. The first is that capital punishment is practiced in most but not all United States jurisdictions. Specifically, there are 34 states with the death penalty, and 16 without. The federal government also maintains capital punishment, as does the military, but the District of Columbia does not carry out executions. However, of these death penalty jurisdictions, only nine regularly carry out an execution, meaning they have averaged at least one execution a year since 1976 when capital punishment was reinstated; thus only about one-quarter (26%) of death penalty states (nine of 34) and 18% of all states in the country (nine of 50) average one or more executions per year. Further, only one state has carried out at least ten executions per year since 1976, Texas. In fact, only about 10% of counties with the death penalty imposed a death sentence between the years 2004 and 2009. Justice is typically defined as administering and maintaining what is just or right. Robinson (2011) says that there are three broad issues discussed and debated by scholars of justice theory: freedom, welfare, and virtue. Some justice theorists argue that what matters most for deciding what is right or just is freedom; whether individual rights are respected and protected. Another school of thought is the egalitarian libertarians. These scholars suggest that what matters most for justice is equality of opportunity in society and taking care of the least advantaged citizens. Other justice theorists focus on welfare, or general well-being and happiness of people in society. They argue that what matters most for justice is the welfare of society, or its overall happiness. Finally, other justice theorists argue that what matters most for justice is virtue, or moral goodness and righteousness. The purpose of the death penalty is incapacitation, deterrence, and retribution. Incapacitation is understood as removing the ability of offenders to commit future crimes. Incarceration is the typical form whereas execution is the ultimate form. Deterrence refers to creating fear in would be offenders through punishment to prevent future crimes. Capital punishment can only be aimed at preventing crime by would-be murderers, general deterrence, since it cannot create fear in murderers who have already been executed, specific deterrence. Retribution refers to righting or rebalancing the scales of justice through punishment in order to achieve justice for crime victims. Executions are often depicted as retribution for the crime of murder, as well as a source of closure for murder victims’ families. Robinson (2011) claims that criminologists and capital punishment scholars overwhelmingly indicate that the death penalty fails to achieve these goals, mostly because of the rarity of death sentences and executions. Logically, if death sentences and executions were more common, capital punishment would be more likely to achieve these goals. Yet we also know that the more frequently the death penalty is used, the greater the costs associated with the policy, including not only additional financial costs but also a greater risk of convicting, sentencing to death, and executing the innocent. This ultimately has great significance for the â€Å"justice† of capital punishment. Van Den Haag (1986) says that the death penalty is an effective form of deterrence because it is feared more than life imprisonment. Many of the convicts under death sentence appeal their sentence and try to get it reduced to life imprisonment. Van Den Haag argues that even though there is no factual evidence that the death penalty deters would be criminals more than life imprisonment, the fact that more people fear the death penalty makes it a better deterrent. Reiman (1985) agrees with Robinson’s view that the use of the death penalty is not successful as a deterrent. He gives four main reasons that refute Van Den Haag’s argument. His first reason is that although people fear the death penalty more than life in prison, nobody wants to spend life in prison either. People do not have the mentality that they can commit a crime because they will â€Å"only† get sentenced to life in prison. Although the person will be alive, they will have all freedom taken from them, which after awhile, can be seen just as horrible, if not worse, than death. Reiman’s second point is that if a person is contemplating committing a crime, they are already facing an enormous risk of being killed in the process. Roughly 500 to 700 suspected felons are killed by police in the line of duty every year and many Americans own their own guns. When taking that into account, it does not seem very likely that the would be criminal will be able to commit the crime without at least being injured by the police or the would be victim. His third reason against Van Den Haag’s view is that using the death penalty is hypocritical. The law states that a person cannot take the life of another, but when they do, their punishment could be death. It is not possible to say murder is illegal and then have it as a possible punishment. He argues that not having the death penalty better exemplifies that idea that murder is wrong. His last point is that it is illogical to practice the death penalty simply because it is feared more than life imprisonment. He says that people would fear death by torture more than lethal injection, so does that mean we should begin the practice of death by torture because more people are afraid of it? Unless it can be proven that the death penalty is a better deterrent than life in prison, Reiman (1985) argues that the death penalty should be abolished. Robinson (2011) says that as for the issue of innocence, there is little doubt that people are wrongly convicted of murder every year and that a handful are even sentenced to death. More than 130 people have been freed from death row during the era of â€Å"super due process† that began in 1976 when the US Supreme Court reinstated capital punishment. Wrongful convictions often occur due to honest errors such as mistaken eyewitness testimony and faulty forensic evidence, but when they occur due to issues such as: false confessions, lying informants, government misconduct, and ineffective defense counsel. There is also little doubt that innocent people have even been executed, although most of the known cases are from prior to the era of super due process in capital sentencing. There remain at least eight widely known cases where men have been recently executed despite serious doubts about their actual guilt. On the issue of executing the innocent, Van Den Haag (1986), makes the argument that the advantages of using the death penalty as a punishment outweigh the unintended losses. He states, â€Å"Miscarriages of justice are offset by the moral benefits and the usefulness of doing justice (139). His argument is that mistakes have and do occur in innocent people being sentenced to death, but the benefits of using it are more important. It would be more of a detriment to society to stop the use of the death enalty than it is when an innocent person is executed. In regards to race, America’s death penalty has always been plagued by serious racial biases. Little evidence remains of the historic discrimination by race of defendant, although state-specific anecdotal evidence suggests blacks are still occasionally discriminated against, especially when accused of killing whites and when juries are overwhelmingly white. Robinson (2011) says that most experts now point to a â€Å"race of victim† effect, whereby killers of whites are far more likely to be sentenced to death and executed than killers of other races and. For example, a comprehensive study of race and the death penalty in North Carolina showed that killers of whites were more than three times more likely to receive death sentences than killers of blacks. In the state, 80% of those people executed since 1976 killed white people; only about 40% of North Carolina homicide victims are white. Further, a study of capital punishment practice in the state from 1999 to 2006 found that blacks who killed whites were 14 times more likely to be sentenced to death than whites who killed blacks. Also, there were six executions of blacks who killed whites during the time period, yet zero executions of whites who killed blacks. Van Den Haag’s (2011) stance on the distribution of the death penalty being discriminatory is that â€Å"punishments are imposed on persons, not on racial or economic groups† (138). The death penalty is not specifically issued to certain races. It depends on the crime that the person committed. Van Den Haag also says, â€Å"Justice requires that as many of the guilty as possible be punished, regardless of whether others have avoided punishment. To let these others escape the deserved punishment does not do justice to them, or to society. But it is not unjust to those who could not escape it† (139). Van Den Haag does not view the fact that black people or other minorities receive the death penalty more than whites as being unjust. However, what is unjust is the white people who were not sentenced to death when they should have been. Given these important empirical realities of the death penalty, the next issue to address is which of them are relevant for the â€Å"justice† of capital punishment practice. As noted earlier, it depends on which theory of justice is being referred to. Libertarians ask whether capital punishment respects liberty or freedom. The most important question for egalitarians is whether capital punishment practice is equal or applied in an equal fashion. For utilitarians, the most important question is whether capital punishment increases overall utility or happiness in society. Finally, for virtue-based theorists, the question is whether capital punishment respects and promotes our values, our moral goodness, and whether it is the right thing to do. The questions above do not have universal answers. Everybody will have his or her own opinions on whether the death penalty respects a person’s freedom or whether it is the right thing to do. Reiman, Robinson and Van Den Haag all made successful and convincing arguments so it is hard to determine one view as more convincing than the other. It comes down to a personal choice and what a person chooses to believe as to whether the death penalty is fair and a proper form of justice.

Cultural Event: Pan’s Labyrinth

XI LIU Cultural Event Paper: Pan’s Labyrinth I like watching movies, and I want to learn about different cultures from different countries. So I attended the cultural event of 2012 Foreign Film Series at 7:00 pm in October 9th. I was so excited that the Art History Organization gave us a chance to watch a Spanish film called Pan’s Labyrinth. I had heard of it before, but I had never watched it. This film combined the fantasy world and the real world perfectly. That is to say, it is a film of magic realism.I was attracted by the plot of the film, and I was astonished by the director’s conception and the visual effects even though a few scenes were a little bit disgusting and scary. The background of the story was traced to 1944, five years after the end of the Spanish Civil War. Spain was shrouded under the haze of fascist dictatorship. Those who were communist party members and the democratic persons were hunted down and killed savagely by the army. The plot of t he movie develops with resistance against forces of General Francisco Franco, whose leader was Captain Vidal and who ruled Spain as dictator.The protagonist Ofelia entered a magic world with three challenges that Pan gave to her. The film opened with the sound of a faint melody which was accompanied by the sound of Ofelia’s breathing and the frames of blood streaming from Ofelia’s nose while she was lying on the ground. With the background of white words showing on the screen and the voiceover telling us Ofelia’s status of princess in underground realm, the story started. Ofelia, who was twelve years old, took her pregnant mother to the north to rendezvous with her stepfather Vidal, whose real identity was a fascist officer responsible for repression of the local guerrillas.The purpose of Vidal’s living with Ofelia and her mother was his flesh and blood son to be born, and Vidal’s only pleasure was to study all kinds of ways to torture people who w ere caught. After watching her cold stepfather doing evil for fun, her sick mother and witnessing violence, Ofelia, who was surrounded by loneliness and fear, became addicted to fantasy for consolation. She was led to a deserted mill which was the entrance to the labyrinth by an insect elf, and the labyrinth porter who had long horns with goats and transparent eyes was waiting for her arrival.Pan told Ofelia that she was actually a lost princess from the underground kingdom and she had to accept three challenges and complete the tasks in order to go back to her kingdom. The first task was to save an old tree. Because there was a huge toad living in the root of the tree, the tree was on the edge of death. She had to take out a golden key from the toad’s stomach. The second task was to use the golden key to retrieve a dagger. In that room, there was an evil creature sitting at a table with a feast of beautiful foods which she could not eat.She was within an inch of her life aft er giving in to temptation. At the same time, her stepfather began more offensive activities of killing people above ground. Ofelia’s struggling with nightmares blurred the boundaries of reality and fantasy. The third task was to use her half-blooded brother’s pure blood to open the door of underground. Ofelia refused this requirement due to her virtuous heart. She didn’t realize that her stepfather had followed her, and she got shot by him.The scene was back to the initial scene of Ofelia’s streaming blood from her nose lying on the ground at the start of the movie. The ending of the movie can be interpreted in two ways. If it was real, she rejoined the kingdom using her own pure blood and opening the door of entrance. If not, then she ended the movie happy and certain that she was going to a better place, with the dictator powerless to stop her. Pan’s labyrinth is a movie based in a real historical background. It is clear to show us the antiwar a ttitudes with the development of the two main plots.However, it combines the cruel reality and the beautiful fantasy world perfectly to indicate the damages and hurt of the Second World War from the angle of a girl’s point of view. The role of Ofelia represents the whole group of children who were the victims who suffered most at that time. They were eager to live in a world of fairy tale. However, the war destroyed their real dream, leaving despair, hate and agony. One of the director’s obvious artistic characteristics is that he did well in applying contrasts to achieve great artistic effects.He uses the nice fairy tale to contrast the cruel reality and the darkness of humanity. The scene at the end of the movie, which was the same as the beginning, gives me a deep impression of an innocence girl. Thus it clarifies the abhorrence to the war and spiritual sustenance of longing for beauty. The question at issue that Pan’s labyrinth brings to us is whether fantas ies can rescue us from fascism. Around this theme, the director set out two main lines of the plot; one is the reality and the other is the girl’s fantasy world. Three challenges that the girl aced with and the atrocities of Captain Vidal which center on the question at issue reveal that fantasies cannot rescue us from fascism finally. In terms of importance, relevance and sufficiency, a very famous writer Justin Zhang for Slant Magazine stated that this film used a large number of symbolisms of blood to unveiled Pan’s labyrinth god’s mysterious veil (Zhang 24). This movie provides us sufficient and detailed content to reflect the inhumanity of Captain Vidal and the innocence of the little girl. The military executed justice with brutality, violence, cruelty, and no respect for civil rights.The examples of Vidal executing the man that was telling the truth about hunting rabbits, the doctor without any trial, and shooting Ofelia for no real crime, in addition to the brutal interrogation methods, embodies the inhumanity of Vidal. When Ofelia’s mother was in dystocia, he chose to save his baby son’s life but not his wife. These examples are important and relevant to reflect the character of Vidal. The example of Ofelia’s giving up using her half-blooded brother’s pure blood to open the door to the underground kingdom indicates her essence of innocence.All these examples of Vidal and Ofelia are important and relevant to the question at issue and the purpose. Pan’s labyrinth is a movie with deep understanding and implications. At first, it conveys a meaningful anti-war topic. The three tasks that Pan gave to Ofelia were to see if she dared to question when she realized that she was wrong. Eating grapes without resisting temptation in the second task and her refusal of handing over her brother indicates that she was an innocent girl with a rebellious spirit. All the settings of the roles and scenes have their u nique meaning.For instance, the scene of Vidal having his mouth cut open by Mercedes is derived from a tradition of Chelsea Smile. British people will cut the traitors’ or the enemies’ mouth as the shape of smile for punishment. The painting of Saturn Devouring One of his Children which was drawn by Spanish painter Goya, hung on the wall in the room where Ofelia finished her second task, is derived from a legend of Greek Mythology. It’s a painting with dark humor to interpret anti-war means. The design of the name of the leading role Ofelia is from Hamlet, written by Shakespeare. This may imply the tragic destiny of the little girl.In short, it is a film that has deep meaning regarding anti-war believing, rebellious spirit and challenges. Not only does it set out an issue that is worth thinking, but it also eulogizes justice and bravery. All these symbolism and settings reflect on its depth and make it a perfect film. However, Pan’s labyrinth does not exi st. It was made up by the director, but it is based on a real background. It is precise in describing all the characters of the roles in detail. And, also, it describes the violent scene more directly, such as the face with bloody pile of flesh and the scene of Vidal’s sewing his own mouth which was cut open.It has a visual power to make us know the cruelty of the reality. The scenes switch with accuracy and precision so that we do not feel the movie boring and long. It arranges all three challenges which interlace with Captain Vidal’s atrocities within two hours. So, I think that the movie is a success in its precision of characterization and mysterious scenes. In all, I like this movie. It gives me both visual impact and strong emotional shock. It’s a fantasy story based on the real history. The fantasy world gives me an illusion of beauty, but the cruel reality makes me sober enough to rethink profoundly and see the history clearly.This movie arouses peopleâ €™s thinking about whether fantasies can rescue us from fascism. The director used the deep symbolism and settings to make the film more thoughtful and have anti-war meaning in depth. The film also gives me a chance to do some research on the background and analyze the implications that the director made. I wish I could watch more movies like this in the future. Work Cited Zhang, Justin. â€Å"The Esoteric Interpretation of â€Å"Pan’s Labyrinth†. †Ã‚  Slant Magzine. 06 2006: 24. print

Mr Makoloyis Personal Profile and View Assignment

Mr Makoloyis Personal Profile and View - Assignment Example Mr Makoloyi says that the problems emanate from the fact that BA had persisted that the crew accept four-year pay pact. This was to see a freeze in actual pay up to 2014, something to which the crew has countered by giving the company a three-year pay cut pact. Although BA management has already rejected this. In addition, the company refused to commit to making longer the legitimacy of the industrial action ballot to let union staff members to be balloted on any suggestion from BA. Consequently, as Modlock (2010) observed, it resulted in another strike, third to be precise, ballot in five months following the rejection of BA’s proposal by cabin crew. Moreover, BA’s unwillingness to address Unite’s concerns about the impact on existing crew gave that the airline is pushing forward with its new fleet plans and especially on how the routes will be allocated among already functioning and the latest crew in the ages to come. Mr Makoloyi also observed that heightened tensions at the BA is caused by the manner in which the management relates with the employees and the stringent rules it has put forth to curb employee misbehavior like excessive drinking, and this has lowed the motivation of employees. Equally threatening an issue, related to pensions. Mr. Makoloyi explains that the announcement by the company in 2003 that it would close its ultimate remuneration scheme to all recently employed workers due to a major shortfall in the pension’s fund led to BALPA, a trade union that stands for BA pilots, threatened industrial action if the final remuneration scheme was reduced to a less generous package. The threat was approximated to have cost the company roughly eighty million pounds while the union projected that the adjustment would make a number of their members to lose 36% of their final pension. BALPA has roughly 2500 members (Modlick 2010).Mr. Makoloyi said that between 2005 and 2006, BA held mo re than 500 briefings with staff pertaining the same issue. All these negotiations with four unions yielded little given that each of these unions had their own unique issue of concern.

Generate ideas fr future research Paper Example | Topics and Well Written Essays - 250 words

Generate ideas fr future - Research Paper Example Thus, I would like to select the topic – â€Å"Recent Changes and Future Potentials in Healthcare Sector†. According to Ranmuthugala, Plumb, Cunningham, Georgiou, Westbrook and Braithwaite (2011), the healthcare industry has been witnessing considerable changes in its governance systems and leadership practices correspondingly. It is owing to these changes that the industry is still perceived to lack a firm leadership framework, resulting in various gaps within its decision-making efficiency (Bercaw, 2013). Munir, Nielsen, Garde, Albertsen and Carneiro (2011) also argued on the gaps still persistent in the healthcare sector, particularly owing to the fluctuations it witnesses in the leadership practices. Thus, it is to test the notion that I intend to consider this particular topic. In order to conduct a research based on the topic I have selected, I would initially conduct a preliminary research to validate my assumptions and draw precise aims and objectives to give further direction to my research. Subsequently, I will select the research design that can best justify my topic, which I expect to be most suitable through a case study analysis method. Correspondingly, I will emphasize collecting data and analyzing the same to justify my perceptions. I will also deliver due significance to ethical considerations that will help me validate my arguments more precisely. Mayosi, B. M., Lawn, J. E., Niekerk, A. V., Bradshaw, D., Karim, S. S. A. and Coovadia, H. M. (2012). Health in South Africa: changes and challenges since 2009. Retrieved from http://uir.unisa.ac.za/bitstream/handle/10500/9521/Health%20in%20South%20Africa.pdf?sequence=1 Munir, F., Nielsen, K., Garde, A. H., Albertsen, K. and Carneiro, I. G. (2011). Mediating the effects of work–life conflict between transformational leadership and health-care workers job satisfaction and psychological wellbeing. Journal of

Compare and contrast Essay Example | Topics and Well Written Essays - 500 words - 2

Compare and contrast - Essay Example Also, along with the teacher, a school counselor should help a child who is struggling with learning or using appropriate behavior. The role of the principal is to ensure that the discipline plan is being used appropriately school wide. Q2. Identify and discuss the three organizing principles about the learner. There are three principles about the learner. The first principle is that the learner should always be treated with respect. The teacher should treat the learner with respect, the other learners should treat each other with respect and the learner should respect himself. The second is that every learner has a great capacity to learn. Although all students start at a different level, they all have a great capacity to learn and grow from the level where they started. Effort will need to be made by the learner and the teacher to help the learner grow. The last principle states that the learner's behavior or performance always has a purpose. The purpose will vary with different le arners in different circumstances. Most misbehavior happens with one of these 4 purposes: seeking attention, seeking power, seeking revenge or lack of self confidence. An example of a student misbehaving who is seeking attention would be a student who calls out at inappropriate times during class.

Intimate Correlation of Media Art and Manufacturing Industry Dissertation - 1

Intimate Correlation of Media Art and Manufacturing Industry - Dissertation Example Manufacturers need to cater to the changing needs of their consumers in order for them to continue with their operations. They need to think of new innovations for their products for them to be globally competitive and for others not to outweigh what they have. It should not be a wonder why manufacturers with this line of thinking have owned the top positions for the best manufacturers in the world. Apple’s Legacy Apple for instance, has come a very long way in producing items that were really suitable for the different tastes of people. As their products continue to innovate, their ability to capture the hearts of the consumers also continue. With this, manufacturers within the same line of business such as Samsung are also following Apple’s steps in innovating their products and giving in to what the customers want. They always come up with ideas that would attend to the latest craze regarding the different gadgets, always leaving their consumers thirsty for more. Whi le it is enough to credit these manufacturers for their ability to innovate and think of new ways to sell their products, it cannot be denied that media art has also affected the success of these manufacturers very effectively. Anyone would be positive in saying that media art can really push consumers to purchase the products that they contain. Advertisements always make a huge impact to customers and it’s the easiest form of influence so that consumers can be attracted to the products. Apple has been in the top of Wall Street for the past years now, since its introduction of the Macintosh personal computers and the portable music players known as iPod. Nowhere in the world can you see anyone who owns any of these gadgets. The way on how these products attained success is a great illustration on how media art and innovation can really be a factor to the manufacturer’s success. Even the littlest image on a magazine, or a small advertisement in a billboards and everythi ng else, if it contains the most important feature that a product has, that would be a plus factor to the manufacturer’s ability to sell. Even as Apple continue to succeed, its owner, Steve Jobs overlooked the fact that he has competitors around. Koontz and Weihrich (2008, pp.331-333) shared what happened between Apple and Windows. Gates has offered Jobs to make the personalized software that he wants, but as soon as Gates took a hold of the Apple’s software, he took advantage of it, and thus, the birth of Microsoft Windows. This only proves that having the most efficient software and resources is not the only key to success in every company. There will always be those who will compete in order to get to the highest position. Microsoft was then successful in pirating Apple’s idea, but the success that the latter has made can still be apprehended for. According to Lussier and Achua (2010, pp.24-25), Apple’s success comes from trying to make things that wou ld be loved by everyone. There is no doubt at this point that everyone loves their products. Together with their brilliant minds, innovation and resourcefulness, media art can always be behind everything that they make. As stated earlier, the easiest way to reach people nowadays and to sell products is through advertising. Media art is a very effective tool in exposing your products in a very simple way. For as long as you know the details to include in the

Capital Asset Pricing Model Essay Example | Topics and Well Written Essays - 1750 words

Capital Asset Pricing Model - Essay Example This model has been heavily criticised and debated over the past decades, and many of the economists are of the opinion that this framework is not adequate enough to assess various risk factors comprehensively. However, none of the opponents could introduce a potential alternative to this concept till date. This paper will critically analyse the applicability of the CAPM in corporate finance applications in the context of modern business environment. Corporate applications of CAPM Hillier et al (2008, section 5.1) provide a detailed view of the corporate applications of the capital asset pricing model. Through a well integrated theoretical concept and empirical evidences the authors give readers an easy understanding of the applicability of CAPM in corporate finance. Through this section, the authors address the misconception that the CAPM theory is applicable only to investment purposes. The application of capital asset pricing model together with mean variance analysis is greatly s upporting corporate managers in decision making process today (Grinblatt & Titman 2003, p. 132). The author argues that a manger is most likely to lose his job if his organisation is continuously struggling with declining stock prices (ibid). Hence every corporate manger is forced to improve the firm’s stock prices at any cost. For this, the manager needs clear understanding of the different elements that determine share value. Such knowledge would greatly assist corporate managers to determine what actions would improve the stock value and thereby serve the interest of stockholders and directors. For instance, the combined application of CAPM and mean variance analysis may help firms to hedge their risk elements to a great extent and â€Å"diversify their portfolios of real investment projects† (Grinblatt & Titman 2003). The CAPM model also benefits multinational corporations to scrutinise their capital expenditure decisions. Management theories and historical evidenc es clearly indicate that thoughtless capital expenditures would lead to corporate failures. Top executives are extremely concerned with the firm’s capital expenditure strategies as they determine the organisation’s levels of sustainability. At this juncture, CAPM assists regulators to frame their capital expenditure strategies by focusing on various factors affecting capital expenditure. This concept is also useful for financial managers to arrive at reasonable conclusions on how to value real assets. Although many of the critics claim that CAPM model cannot be used for valuing real assets, majority of corporations are still cantered on this model. However, scholars like Lee et al (2009) strongly believe that CAPM can be very useful in real asset valuation. While analysing the historical growth phases of CAPM, it seems that corporate managements have been using this model in their all areas of financial analysis and planning since the development of this concept. Schol ars opine that capital budgeting is one of the major corporate applications of the CAPM. If it is possible to predict the systematic risk associated with a project accurately, then the CAPM can be applied to compute the risk adjusted discount rate which is essential to compensate the organisation for the risk elements of the project. â€Å"

Theres a Gender Pay Gap in Kids Allowances and Parents Are To Blame Essay

Theres a Gender Pay Gap in Kids Allowances and Parents Are To Blame - Essay Example The way parents bring up their children has a direct effect on the future choices being made by children pertaining to their choices of work and work-related activities. Parents are responsible for directing children mindset to value professions like law, Medicine among others and devalue others such as house chores and teaching. The majority of the gap seen in the pay between men and women in the society comes from the occupational differences and not the gender role differences (Eliana). The pay gap clearly demonstrates to the girls that the kind of household work that they do does not qualify in the level of works that need to be rewarded. This is why when girls grow up into womanhood, they tend to spend most of their times on the work that is unpaid such as household chores. In contrast to women, men only try to find more time to relax themselves out . Normally, girls do two more hours of daily chores when compared to boys. On the other hand, boys do spend much of their time, twice as much as the girls, in playing. Despite this hard work shown by the girls, boys are likely to be paid for the chores that they do. A similar research done by the junior achievement USA indicates that seventy percent of all boys are more likely to get allowance as compared to a small figure of sixty percent of girls, who are likely to receive allowances. According to Sandberg and Neil â€Å"Lean in: women, work and the will to lead â€Å"; gender pay difference is also a result of the gap in leadership ambition. In many working environmental, men are observed to be more ambitious to achieving senior jobs compared to their female counterparts. A 2012 Mc Kinsey survey found out only eighteen percent of women in a working environment aspire for the senior jobs that are high paying compared to thirty-six percent of the men population in the same environment (Sandberg and Nell, 13). It is no doubt that women do possess equal skills to

Clinical Biochemistry Essay Short questions(degree)

Clinical Biochemistry Short questions(degree) - Essay Example To diagnose Cushing’s syndrome levels of free cortisol are checked in the urine. Levels of cortisol in the saliva and serum are checked at midnight to confirm the disease. Dexamethasone which is a synthetic glucocorticoid is administered which leads to decreased cortisol if the increased levels are due to a tumor in the anterior pituitary. Addisons disease is characterized by insufficiency of cortisol which is caused mostly due to production of antibodies against the adrenal gland within the body. This leads to decreased glucose metabolism in the body causing hypoglycemia and it can prove to be fatal in periods of stress and mild infections. Hyperpigmentation is also seen. Levels of free cortisol are checked in the urine and serum and saliva levels of cortisol are checked at midnight. Adrenocorticotropin hormone is then administered and levels of cortisol are measure. If they do not rise it indicates the insufficiency of the adrenal gland and rules out any problem with the ant erior pituitary. Radioimmunoassay is a technique in which a known quantity of labeled antibody and a labeled antigen is taken. This known complex is added to with unknown quantity of serum containing the antigens which needs to be measured. The unlabelled antigen displaces the labeled antigen and combines with the antibody. This unlabelled antigen and antibody is measured. Different quantities of serum are taken and added to the labeled complex and a graph is plotted and the values for the antigen in serum are measured. This method is extremely sensitive and specific because the antigen and antibody complexes formed are very specific for each other. It is also very sensitive because it can detect small amounts of antigen. The results obtained are accurate if many samples are taken. To improve accuracy it is important to purify the sample as well the reactants from foreign particles to prevent any false results. More samples

A grammar test to an intermediate level Assignment

A grammar test to an intermediate level - Assignment Example For a longtime teachers have had a hard time trying to determine whether their students have grasped the various learning concepts tests were therefore introduced to enable teachers asses the learning levels of their students (Harmer 2007, Pg 2). Prior to any testing exercise, teachers often put many factors into consideration, such, may include the age of the students, the topics covered under study. One of the importances of testing the intermediate students English language levels is that it helps the teacher make various decisions regarding the teaching models to use.   Teachers have various styles of teaching and such may affect the students understanding of the given topic (Hughes 1989, pg 15).   The testing therefore enables teachers to tailor their teaching styles to fit the students that are being taught. In the face of ever changing English and language developments, the testing of students gives them exposure to these changes. Students at intermediate levels may not ha ve so much grasp and command of the English language, however, through testing the teachers may introduce elements that will be suitable for their learning (Yule, 2000 Pg 17). Therefore, testing of this kind allows the teacher to determine what the learners ought to know and the various changes that are talking place in the English language. Through testing, the teacher will be able to know the various interests of the learners especially in regards to the learning styles applicable in teaching them.   For instances students that are convergers.... Prior to any testing exercise, teachers often put many factors into consideration, such, may include the age of the students, the topics covered under study. One of the importances of testing the intermediate students English language levels is that it helps the teacher make various decisions regarding the teaching models to use. Teachers have various styles of teaching and such may affect the students understanding of the given topic (Hughes 1989, pg 15). The testing therefore enables teachers to tailor their teaching styles to fit the students that are being taught. In the face of ever changing English and language developments, the testing of students gives them exposure to these changes. Students at intermediate levels may not have so much grasp and command of the English language, however, through testing the teachers may introduce elements that will be suitable for their learning (Yule, 2000 Pg 17). Therefore, testing of this kind allows the teacher to determine what the learne rs ought to know and the various changes that are talking place in the English language. Through testing, the teacher will be able to know the various interests of the learners especially in regards to the learning styles applicable in teaching them. For instances students that are convergers are often solitary and may not like learning in the same environment as the others (Yule, 2000 Pg 17). Through this the teacher will be in a position to identify the conformist students who have preference to studying the language rather than using the language. Others like concrete learners and the communicative learners will also be identified and the teacher will come up with various teaching models that are suitable for them. Having knowledge on the type of students in your

Obsessive-Compulsive Personality Disorder Essay Example for Free

Obsessive-Compulsive Personality Disorder Essay Obsessive-Compulsive Personality Disorder (OCPD) is a personality disorder which is characterized by a pervasive pattern of preoccupation with orderliness, perfectionism, and mental and interpersonal control at the expense of flexibility, openness, and efficiency (Taber, 1968). This pattern begins by early adulthood and is present in a variety of contexts. Individuals with Obsessive-Compulsive Personality Disorder attempt to maintain a sense of control through painstaking attention to rules, trivial details, procedures, lists, schedules, or form to the extent that the major point of the activity is lost (Criterion 1). OCPD and OCD are often confused as they are thought of as being similar. There is, however, a great difference between the two conditions. A person with OCD experience tremendous anxiety related to specific preoccupations, which are perceived as threatening. Within the condition OCPD it is one’s dysfunctional philosophy which produces anxiety, anguish and frustration (Phillipson). History of Obsessive-Compulsive Personality Disorder: Back in the early 1900s, Freud observed and treated patients with OCPD. From his findings, he noted, â€Å"persons with obsessive-compulsive personality disorder are characterized by the three ‘peculiarities’ of orderliness [which include cleanliness and conscientiousness], parsimony, and obstinacy. † He also called it, â€Å"a neurosis connected with difficulties at the anal phase in psychosexual development,† and made a distinction between Obsessive Compulsive Disorder (OCD), which he referred to as a â€Å"symptomatic neurosis† and OCPD, which he referred to as a â€Å"character neurosis† (Skodol Gunderson, 2009). In 1918, Ernest Jones went on to describe someone afflicted with OCPD as being overly concerned with money, cleanliness, and time. The observations from these men were important at the time, because not much was known about this disorder. Literature begot the term â€Å"anal character†, combining the character (personality) neurosis (anxiety), and according to Freud, OCPD begins development in the anal phase of development (Skodal Gunderson, 2009). Obsessive-Compulsive Personality Disorder tends to occur in families, so genes may be involved. A person’s childhood and environment may also play roles. As with all personality disorders, the person must be at least 18 years old before they can be diagnosed. OCPD is approximately twice as prevalent in males then females, and occurs in about 1 percent of the general population. It is seen in 3 to 10 percent of psychiatric outpatients. Like most personality disorders, Obsessive-Compulsive Personality Disorder typically will decrease in intensity with age, with many people experiencing few of the most extreme symptoms by the time they are in the 40s or 50s. Their ability to work with others is equally affected, since they have symptoms perfectionism. This perfectionism may interfere with the person’s ability to complete tasks, because their standards are so rigid. People with this disorder may emotionally withdraw when they are not able to control a situation. This can interfere with their ability to solve problems and form close relationships. Personality disorders such as Obsessive-Compulsive Personality Disorder are typically diagnosed by a trained mental health professional, such as a psychologist or psychiatrist. Psychological test that may help diagnose this condition include: †¢The Structured Clinical Interview for DSM IV Disorders (SCID II) †¢The Schedule for Non-Adaptive and Adaptive Personality (SNAP) Treatment options for Obsessive-Compulsion Personality Disorder include medications such as selective serotonin reuptake inhibitors (Prozac) may help reduce some of the anxiety and depression from this disorder. However, talk therapy (psychotherapy) is thought to be the most effective treatment for this condition. †¢Psychodynamic psychotherapy helps patients understand their thoughts and feelings. †¢Cognitive-behavioral therapy (CBT) can also help. In some cases, medications combined with talk therapy may be the more effective than either treatment alone. Hospitalization is rarely needed for people with this disorder, unless an extreme or severe stressor or stressful life event occurs which increases the compulsive behaviors to an extent where regular daily activities are halted or present possible risks of harm to the patient. Many support groups exist within communities throughout the world which are devoted to helping individuals with this disorder share their common experiences and feelings. Such support groups are recommended to individuals suffering from this disorder, especially if they found therapy unhelpful or too expensive. Many people with Obsessive-Compulsive Personality Disorder don’t seek treatment. People with personality disorders, in general, do not often seek out treatment until the disorder starts to significantly interfere or otherwise impact a person’s life. I think that the outlook for people with Obsessive-Compulsive Personality Disorder tends to be better than that for other personality disorders. The four major complications for OCPD are: anxiety, depression, difficulty moving forward in career situations and difficulties in relationships. I strongly believe that being informed about this condition’s manifestations, people can better seek appropriate treatment.

Power subsystem Microsatellite

Power subsystem Microsatellite This subsystem is responsible for supplying power to the entire satellite, converting solar cell energy to on-board battery energy, and distributing power to various other subsystems. The power subsystem of the microsatellite is designed for a remote sensing mission to carry out on sun-synchronous orbits at 700 km altitude at an inclination of 98.19 degrees. The payload of the microsatellite includes a multispectral remote sensing camera which takes picture of polar region in a visible spectrum and a surrey GPS receiver especially designed for low earth orbit. Microsatellite payload weighs 5 kg and with a mean power consumption of 9W. Sub-system power budget is estimated according to the payload power requirement with 15 percent margin. Total estimated power requirement for the microsatellite is 70W. Microsatellite subsystem Power Allocation :- End Of Life Estimated Microsatellite Power 70 W Subsystem % of Operating Power Power (W) Payload 15 10.5 LSTS Bus Propulsion 0 0 Thermal Control 10 7 Attitude Control 15 10.5 Power 15 10.5 Communications 20 14 C D Handling 10 7 Structure 0 0 Margin 15 10.5 Total 100 70 The power subsystem of the microsatellite is designed for Low Earth Orbit for five years period. The power estimated for subsystem has a 15% contingency margin. Primary power source for the satellite is the solar array that is body mounted on the microsatellite. The satellite is in near polar sun-synchronous orbit at an altitude of 700 km, total orbital period of the satellite is 98.77 min. The microsatellite experience eclipse for about 35.29 min. Solar array for the microsatellite is designed according to the mission requirement. Batteries are secondary power source during the eclipse when no sun light is available. The selection of the solar cell and batteries are made according to power required end of life of the satellite and trade study between different solar cell and batteries but decision is made to satisfy the estimated mass size and power budget of the satellite. As the satellite is a cube shaped and spins stabilized body mounted solar panels to places on all the four sid es of the satellite for a uninterrupted supply of power to the subsystems. Altitude 700.00 km Earths Radius 6,378.00 km Total Power Requirement (const. day and night) 70.00 Watts Earths Gravitational Constant 3,98,600.00 km2/s2 Power transfer efficiencies:- Xd 0.85 Xe 0.75 Inherent Degradation Id 0.80 Worst Case(ÃŽ ¸ deg) 23.00 (deg) Mission Life (yrs) 5.00 (Yrs) Life time Degradation (Ld) 0.98 Angle ÃŽ ± (rad) 1.12 (rad) Angle ÃŽ ± (deg) 64.30 (deg) Orbital Peroid (P) (sec) 5,926.21 (sec) Maximum Eclipse Peroid (Tn) (sec) 2,117.08 (sec) Minimum Power Sunlight (Td) (sec) 3,809.12 (Sec) Average Solar array power (Psa) (W) 134.23 W Multijunction Solar (GainP/GaAs) Po 301.00 W/m2 BOL Power (Pbol) 221.66 W/m2 EOL Power Requirement (Peol) 216.17 W/m2 Solar array Area (m2) 0.62 m2 Mass of Solar Array (kg) 3.36 kg Solar array weight ( body mounted so Msa x 4 ) 13.42 kg The primary power source of the microsatellite is chosen to be Multijunction Solar cells (GainP/GaAs). These solar cells have an efficiency of 23 percent and most advanced for their category. The required solar panel area of the microsatellite to sufficiently support the power requirement of the microsatellite subsystem is 0.62 m2 but for a body mounted microsatellite, all the four faces of the cube shaped satellite will have the following area. The estimated weight of the solar panels is 3.4 kg and the total weight of all the panels on the satellite is 13.5 kg. The main advantage of the body mounted solar panels is such that they have more life expectancy as they are not exposed to radiation for a long time, but it is compensated with the additional weight of the solar panels. The primary power source should be able to generate 135 Watts of power to sustain the power requirement of the subsystems as well as enough to charge the batteries as they are the secondary power source of the mission. For Given Ni H cell Assuming Data for 700 km altitude Energy Density 100.00 W.h/kg DOD 1.60 0.27 log10 [cycles] Power during Eclipse 70.00 W Altitude 700.00 km Battery Voltage 28.00 Volts Xb-l 0.90 No .of eclipes per day 15.00 5 year Mission Orbital Peroid (P) (sec) 5,926.21 Sec Time of Night (Tn) (sec) 2,117.08 Sec Eb (energy supplied during eclipse) (W.h) 45.74 W.h Cycles 26,607.25 Depth Of Discharge (DOD) 0.41 1a)Ebcap (energy battery capacity required) (W.h) 112.87 W.h 1b) Battery Capacity (A.h)(assuming voltage is 28 v) 4.03 A.h 2. Total Battery Mass (kg) 1.13 Kg The secondary power source is required to generate power during eclipse in the orbit to sustain microsatellite subsystems. The secondary power source for the mission is chosen to be NiH batteries as they are good for long cycle life and they have advantage of mass and volume over most of the current batteries available. They have good specific energy density of 50 W.hr/kg. The main advantage of these batteries is such that they are widely used in space mission and constantly updated with new technologies. They have depth of discharge of 40% that is good for this kind of mission. Total secondary power source weight is 2.3 kg. (((((((((( References SMAD and System Integration Aegis)))))))) Communication subsystem The communications subsystem is the lead for the interface between the satellites and the ground stations. The communications subsystem helps in demodulating the received uplink signals and transmitting downlink signals .The subsystem also helps us to maintain a track over the satellite by transmitting received range tones and by acting as logic between receive and transmitted signals. Data Rate The remote sensing microsatellite is designed for a Low Earth orbit at an altitude of 700 km. The payload of the satellite is a multispectral camera that takes picture of the poles in visible spectrum. The 20 degrees minimum elevation angle and a resolution of 50 is assumed for the satellite and the data rate is calculated for the satellite. Altitude (km) 700.00 Radius of Earth (km) 6378.14 Orbit Peroid (mins) 98.77 Ground Velocity ( km/s) 6.76 Node Shift (∆L = S) (deg) 24.76 ÃŽ µ (deg) 20.00 ÃŽ · (deg) 57.86 Zc 27818.52 Za 133.06 Z 3701467.63 DR (Visible)(bps) 37014676.33 Maximum Time in View (min) 6.66 The data rate calculated is 37Mbps adding 10 percent margin data required to send back to ground station is estimated to 40Mbps. Band Link Technology For the current microsatellite mission an S-Band telecommunication system is researched, analyzed, and chosen as the best system for establishing communication between satellite and the ground station. Application Specifications Downlink Rate Max 2.5Mbps Power RF Output .4W Power Consumption 3.4W Weight 420g Volume 190X135X22 mm3 The table above shows the specification if the Surrey Satellite S band communication system transmitter details. This has an advantage of low mass, power and data rate which completely satisfy the mission constrains. The above transmitter system also has a S-Band antenna for this transmitter which has specifications as follows.(((((((((((((((((((memo com2 // surrey satellite)))) Specifications Number of Antennas Needed 4 3dB Beamwidth  ± 35 ° Weight 80g Volume 82X82X20 mm3 Link Budget Link budget for the system S band communication system is designed considering the factor to transmitting the data rate of 40Mps within 6.5mins or 400 sec. The link budget is a process of accounting all the possible gains and losses during transmitting and receiving the signals from transmitter to receiver. The equations below are used to determine link budget: Total spacecraft received power (uplink budget) Uplink Signal to Noise ratio (Will help determine probability of bit error) Total Ground Station received Power (downlink budget) Downlink Signal to Noise ratio (Will help determine probability of bit error) 2.4.1 Slant Range The Slant range was calculated as follows for a 5 degree elevation angle. 2.4.2 Attenuation of the Signal The biggest contributor to the attenuation of the signal is free space loss. There are many other losses such as cable loss, polarization loss, cloud, rain, etc. The frequency used for the S-Band calculation is 2.2GHz. Atmospheric loss is caused by absorption due to such factors as oxygen and water vapor in the atmosphere. Atmospheric, rain, clouds and ionosphere scintillation were assumed to be 0.5dB for 2.2GHz. Further investigation into these effects needs to be completed next semester. With X-Band the total loss due to these factors was calculated to be 0.76dB. S-Band is expected to have a much lower loss. Polarization loss was estimated from [9] 2.4.3 Calculating EIRP There will be passive losses in the equipment such as losses in the coax cables. This number was used from the previous year. Power transmitted was obtained from the specification on the Surrey transmitter as 0.4 Watts. Looking at the Co-Polar gain on Figure 2 it is seen that there is a gain of at least 0dB for angles between +/- 70 °. 2.4.4 Ground Station Antenna Gain Using an antenna that is 4.5m in diameter with efficiency of 0.55 the gain is calculated as follows: 2.4.5 Signal to Noise Calculation The signal to noise ratio will determine the Bit Error Rate (BER), as determined from the following graph [8]. From this graph it can be seen that to obtain a Bit Error Rate of 10-5 which is typical of space missions, a signal to noise ratio of 4.4 dB is needed. The Link Budget calculations will determine if the system will meet the 4.4 dB of signal to noise ratio at the ground station. System Noise is a function of temperature and was determined from table 13-25 [2]. 4.8dB is above the minimum 4.4dB theoretical signal to noise ratio required. This leaves only a 0.4dB margin which needs to be approved upon. The output RF power could easily be increased from 0.4Watts by using an amplifier, but would be at the expense of the satellite power budget. The Surrey Satellite equipment is a viable solution. Thermal Subsystem The thermal control subsystem is the integral part of the satellite design. It helps out all the components that are exposed to thermal environment are not affected badly. Thermal control subsystem accomplish safe working of all the satellite subsystems and their components by constituting a thermal model.The following process includes inputs from different subsystem of the satellite by identifying the thermal loads that will acting on them during the mission lifetime as well as their operating tempertature for the smooth running of the mission. Thermal Loads The satellite experience or exposed to thermal enviroment during gound testing, transportation, launch , orbit transfer and operational orbits. The thermal environment concerned is during its operation in space. There are four main loads acts on the satellite during its mission.(smad) Direct Solar Radiation: The main source of direct solar radiation is the Sun. It is major source of environmental heating on the satellite, it is a stable energy source and it constant to the fraction of second. The intensity of the sunlight on the earths mean distance of 1 Astronomical unit (AU) is 1367 W/m2. Earths Albedo: Albedo is the reflected sunlight reflected from earth . It is highly as it is the fraction of incident sunlight that is refected back to space. Refletivity increases over land rather than in oceans. Reflectitivy increases with decreasing local solar -elevation angle. Earths Infrared Energy: It is also refereed as blackbody radiation, all incident sunlight do not reflected back as abledo rather earth absorbs it and re-emit it as IR (infrared Energy ) or blackbody radiation. Free Molecular heating: This load is result of the bombardment of the individual molecules present in outer reaches of the atmosphere. It affects during the launch ascent of the satellite. The thermal control susbsystem is designed for a sun synchronous Low Earth Orbit at an altitutde of 700km and at an inclination of 98.19 degrees.The main aspect in designing the thermal control system is to first define the worst case hot (maximum loads) and worst case cold (minimum loads ) acting on the satellite in the orbit and the opertonal temperature operational and survival temperature of each component installted

Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis Jacq Detection and expression profiling of two novel transcripts encoding RIP from Elaeis guaneensis Jacq. in Ganoderma boninense interaction 1. Introduction Among several oil-producing plants, oil palm (Elaeis guineensis) is a tropical crop which is exclusively grown for oil production. Its high oil yield is extracted from oil palm’s thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) compared to other oil-producing plants. The extracted oil has been used widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007; Murphy 2009; Alizadeh et al. 2013). Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a â€Å"white rot fungus†. The lignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Indonesia have suffered the most severe losses from the BSR; furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985; Idris et al. 2004; Rees et al. 2007). Oil palms of different genetic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004; Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this study, we have isolated one cDNA encoding RIP’s EST, from oil palm. Its expression in oil palm root infected by G. boninese; was investigated to shed light on its potential involvement during early disease development. 2. Materials and methods 2.1 Sample preparation A total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in each group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, while the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leaves, roots and stem cell were frozen in liquid nitrogen and stored at -80 °C (Tan et al., 2013). 2.2 RNA extraction Total RNA was extracted from treated and untreated oil palm root tissues using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very find powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer [ 2% (w/v) cetyl trimethyl ammonium bromide, CTAB; 100mM Tris-HCl, pH 8.0; 2M NaCl; 25 mM ethylenediamineteraacetic acid, EDTA; pH 8.0; 2% (w/v) polyvinylpyrrolidone, PVP; and 2% (v/v) ÃŽ ²-mercaptoethanool]. Equal volume of chloroform/isoamylalcohol (24:1, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4 °C. The upper layer was transferred into a new tube and equal volume of phenol/chloroform/isoamylalcohol (25:24:1, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4 °C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) – treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4 °C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80 °C for overnight. After centrifugation, the pellet was washed using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturer’s instructions. Figure : Total RNA from various treated and untreated oil palm tissues. Lane A: Untreated control seedling. Lane B: Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root 3. Semi-quantitative Reverse transcriptase (RT-) PCR 3.1 Isolation of cDNA Omniscript â„ ¢ Reverse Transcriptase kit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIP’s type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu). 3.2 Sequence analysis of cDNA Semi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturer’s instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011). 3.3 Expression profiling Expression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturer’s instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to generate calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreate d negative control. Fold changes of ≠¥2- fold or ≠¤0.5-fold were considered as significant. 3.4 Statistical analysis A one-way analysis of variance (ANOVA) was used to determine statistical differences (SPSS version 17;SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncan’s multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011) 4. Results 4.1 sequence analysis EgRIP-1b The partial cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From Barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5) (Naher et al., 2011) M I C E S I R F E R I S E F L A T E F P G S S K P P K TGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAA W M P A L E H G W G D L S A A L L R A D A N P D R P F TGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCA Fig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT. 4.2 sequence analysis EgRIP-1a The partial cDNA sequence EgRIP-1a (GenBank ID: ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b) M R P T P N F H Y E W S A CAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTC L S K Q TCTCCAAACAA Fig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a. Fig. 4: multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. (a) (b) Fig. 5: Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. 4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculation A total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P>0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011). EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively; before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues. (I) diseased (II) healthy (a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997) a) b) Fig. 7. Expression level mean in each biological replicate a) in root; b) in stem (I) diseased (II) healthy (a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997) a) b) Fig. 9. Expression level mean in each biological replicate a) in root; b) in stem Fig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control. References Alizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. doi: 10.1007/s11105-013-0595-y Durand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 159:93–100. doi: 10.1007/s11046-004-4429-1 Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8:425–428. Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. Journal of Oil Palm Research 16:12–18. Murphy DJ (2009) Oil palm: future prospects for yield and quality improvements. Lipid Technology 21:257–260. doi: 10.1002/lite.200900067 Paterson R (2007) Ganoderma disease of oil palm—A white rot perspective necessary for integrated control. Crop Protection. doi: 10.1016/j.cropro.2006.11.009 pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology and epidemiology. Mycopathologia 159:129–137. Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ); mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58:982–989. doi: 10.1111/j.1365-3059.2009.02100.x Rees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi: 10.1111/j.1365-3059.2007.01621.x Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi: 10.1016/j.jplph.2013.05.009

Leaders in Business Essay -- essays research papers

The business sector in today’s society is increasing rapidly, and with this increase comes the need for more people to manage and lead growing companies. This growing need also raises some potential questions: Can anyone become a leader or a manager? Is there a difference between the two? Can people be trained to become leaders or managers? Just like many other questions that might be asked in business; these questions have no one, definite answer. Let’s begin first by acknowledging the definitions of the two root words; the word â€Å"manage† means to handle, where as the word lead means to go. Similarly as the two words have different definitions, they also have different purposes. To help individuals increase their potentials in business, an internationally recognized motivational speaker by the name of Marc Sanborn has developed certain â€Å"theories† that, much like in science or art, prove some things to be more true than others by providing suppor ting facts to prove the validity of certain ways of thinking. Many of Marc’s theories validate the fact that in general, good managers tend to be good leaders, but good leaders are not always good managers. It is said, "Any company that cannot imagine the future won’t be around to enjoy it." Therefore before any manager or leader can affect changes in their business they have to do what Marc describes as visioning; they must mentally â€Å"look† into what they want to see as the potential outcome of any given situation. Managers are concerned with the problem at hand; they focus on what has to be done. Leaders on the other hand, notice what has to be done, but spend their time figuring out how to get it done. Marc states â€Å"managers vision the destination, leaders vision how to get there†. To be an effective leader it is important to focus on the gritty details of a situation, look for opportunities and how to achieve them. Visioning cannot be taught but can be developed. Marc suggests people start from the end and work backward, or think to themselves â€Å"what will this team accomplish because of me?† Leadership is all about taking an organiza tion to a place it would not have otherwise gone without you, in a value-adding, measurable way. When you vision, you think your way into a situation and it is the approach in visioning that separates managers from leaders. Visioning however is not the only method that separate... ...by now that there indeed is a difference between managers and leaders and it is eventually the approach taken upon certain methods that is the determinant of your leadership role. Marc Sanborn explains that managerial power is positional power; it is power over people whereas leadership is supportive power, and it is power with people. Whether you vision the destination, or the transportation there, whether you try to be efficient or effective, and whether you focus on the speed or the path all come into play as your leadership quality level. These qualities can be improved and developed, if they are all focused on the right things. That is why good managers tend to be good leaders, because they can focus on getting tasks done efficiently and also do it right at the same time. Managers are good disciplinarians; they are able to manage certain objectives while being efficient. However good leaders are more supportive and creative and might sometimes lack the disciplinary quality o f getting the right thing done as efficiently as possible. For the most part, there is a very fine line between good managers and good leaders, but good leaders just aren’t and do not want to be, managers.

The Others :: essays research papers

The Other   Ã‚  Ã‚  Ã‚  Ã‚  Gananath Obeyesekere argues that â€Å"one cannot escape the politics, ethics, and quandaries of representation even as we try to describe the Other.† This argument has lead to a great debate between him and another anthropologist, Marshal Sahlins. Obeyesekere believes that even though we try to give an objective portrayal of another, we cannot help judging them by our own standards. Sahlins on the other hand, says that it is possible to describe other people in an objective way, as long as you have evidence. These anthropologist’s arguments were focused around the apotheosis of Captain Cook. The major debate between the two resides in the idea of representation, and an outsider’s ability to understand another culture. This debate on the concept of representation can be applied to the movie, My Son the Fanatic, in which two cultures are represented- Western and Muslim.   Ã‚  Ã‚  Ã‚  Ã‚  In the movie My Son the Fanatic, we see two cultures being represented. The first is that of a Western Capitalist, racist- acted out by the character, Schitz, who was a German businessman. The other culture was that of violent, Muslim fundamentalists- acted out by Farid, the son of Parvez. This movie was written by Hanif Kureishi who was the son of a Pakistani father and an English mother. Because Hanif was a Pakistani, it is expected that he would be able to objectively portray the Muslims in the movie. I think that he did a good job at doing so. He showed that some of the Muslims were violent fundamentalists such as Farid, and he also showed examples of Muslims that were not so extreme such as Parvez. Farid led violent riots to destroy the prostitutes, burned down their house and attacked Bettina, a prostitute that was also Parvez’ friend. If this was the only type of Muslim portrayed throughout the movie, it would have been a stereotypical film; however, Hanif also showed that there were Muslims such as Parvez that were not violent fundamentalists- Parvez even befriended a prostitute.   Ã‚  Ã‚  Ã‚  Ã‚  Unlike his un-bias representation of Muslims, Hanif lacked objectivity in the representation of the Western culture within the film. This culture had only one character that was portrayed as being evil; it seemed very stereotypical on this behalf. The character of Schitz was portrayed as a Western Capitalistic, racist. Schitz was personified as being very selfish, only thinking about his on pleasures and money. The idea of Westerners being all about money is a major stereotype.

Peter Ilyich Tchaikovsky , composer :: essays research papers

  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã¢â‚¬Å" A Great Composer† Peter Ilyich Tchaikovsky was born on May 7, 1840. When Peter was born his family lived on a small estate in Votkinsk, a town near the Ural Mountains in central Russia. His father was French but his mother was Russian. She played the piano, and little Peter soon imitated her. His father had moved to Moscow when he was eight years old. When he later moved to Moscow , he attended the school of Jurisprudence. Sadly, Peter’s mother died in the summer of 1854 of cholera. Peter later begins his music career. Some of his first ballets were Juliet in Romeo and Juliet, Joan of Arc, O'dette . In his ballet Swan Lake, a woman cursed by a wizard is changed into a swan. Peter had a #1 symphony called Winter Dreams in 1868. He met a Belgian singer named Desiree Artet. In a few months after their relationship started, she married someone else. After the terrible breakup, Peter started to compose all around the world. He had his symphony #2 which was nicknamed , â€Å"The Little Russian.† He originally wrote Piano Concerto #1 in 1875 and became very famous. At one time, he was Russia’s most famous composer. In the year 1876 he premiered Swan Lake, where he met face to face with Russia’s most famous writer, Leo Tolstoy.   Ã‚  Ã‚  Ã‚  Ã‚  In March 1877, Swan Lake was performed for the first time. Today it is considered the greatest ballet anyone has ever seen. In 1877, the Queen of England asked him to compose a simple piano and violin arrangement. Peter was later found out to be a homosexual. Perhaps he felt he had to keep his sexual orientation a secret. On night he attempted suicide because of all the stress he had been through in his life.

Interpersonal Skills

According to Investigated, interpersonal skills are skills used by a person to properly interact with others. In the business domain, the term generally refers to an employee's ability to get along with others while getting the job done. Interpersonal skills include everything from communication and listening skills to attitude and deportment. Good interpersonal skills are a prerequisite for many positions in an organization. (http://www. Investigated. Com/terms/I/interpersonal-skills. SP) My Interpersonal skills: Communication- I believe communication Is vital In everything we do, from relationships to the workforce. I am efficient when I am talking to customers or my coworkers. Conflict- rather It may be In my home or the workplace, I Just take a deep breath and analyze the whole situation. I do what I can to resolve the conflict, because tension only makes the job harder. Anger- I am not easily enraged. I am very self-disciplined and was raised in a good background. Have great wor k ethics and I know how to deal with situations that may seem to be crawling up a wall.I always stay calm. Teamwork- I understand you can't always work alone, so I am also very productive with working in teams and making sure that the team and myself can et everything done and that they can also depend on me. Decisive- I can make good decisions when something doesn't go as planned. Inter Skills Self-Assessment: So tell me about yourself? I am a hard worker and there Is nothing that will slow me down. I had a daughter at an early age of my life and some would say that stops you or slows you down from being able to follow your dream.Well for me It TLD. I wanted to make sure she had everything she needed, so I worked hard to become an electrician as soon as I graduated from high school and from there on in my life I only pursued more knowledge and a higher education. I expanded my horizon to get where I am today and I am still moving forward. What is your greatest weakness? My greatnes s weakness is that I'm very detail oriented so I sometimes spend too much time on one thing. What is your greatest strength? I have great work ethics. When you need me I am there.I make sure my work is done in a professional manner and clean, which sometimes may be time consuming. Tell me about your work history? I have only had three Jobs my whole life. Eve never been a Job bouncer. Started working at sonic soon as I was legal to work. I went to vetch while attending high school to be an electrician, my teacher trusted In my work and my ability to be a good electrician so as soon as I graduated from high school, he put in the good word at the became a security technician. What were your responsibilities? At sonic I worked hard and long hours and became a cook leader.As an electrician I put in receptacles, bent pipe, and pulled wire. As a security technician I do Access Control, Networking, CATV, Burglary, and Fire Why do you want this Job? I want to be in my career doing something that I will love for the rest of my life. Being able to grow and learn as much as I can and one day be able to teach others. Not only that, but making sure my family is secure as well. Challenge and overcome Intellectual Me: Strength: When life seems to get unbearable, I listen to my intellect rather than letting my emotions or feelings run me.The Future: This strength will allow others to trust me when no one else may be able to handle a situation. Challenge: I sometimes get frustrated with others when they let their emotions run wild. Overcome: I will try to understand others more and their background before Judging them, not as a errors, but Just how they handle problems in their life. Moral Me: Strength: I have a very strong work ethic. I like to prove to my boss and coworkers that they can always depend on me and they don't ever have to worry about me not completing the Job.The Future: This strength will continue to open more doors for my future. Challenge: I sometimes spend to o much time trying to make Jobs to perfection, so more time is wasted. Overcome: I plan to work at a faster pace, but make sure everything is in order and that I do not miss any steps. Cultural Me: Strength: I am not ashamed of where I came from and I'm not scared to show others just because of my ethnicity, does not mean I can achieve greatness. The Future: I will work hard to be great at what I do and people will know I'm proud of who I am and where I'm from.Challenge: Somewhere there is always someone will Judge you. Overcome: I will not let it bother me, I will always prove them wrong. Visionary Me: Strength: I always visualize where I want to be in the future and how am I going to do it. With God Eve been successful so far. The Future: I see myself being where I want to be from the hard work and planning that Eve been doing my whole life. Challenge: There is always an obstacle that may slow me down. Overcome: I always find a way to get past it, because I always realize how far Eve made it in the here and now, and to where I want to be in the future.Physical Me: Strength: I'm very athletic. I love to work out and maintain a strong physique and healthy lifestyle. The Future: I plan to stay healthy and stay in shape no matter how old I get. Challenge: I need to slow down on fried foods and start eating healthier. Overcome: I will find a more healthy eating style. Strength: I don't let my emotions get in the way of my work. The Future: My employer will trust my Judgment even in hard times. Challenge: I don't really show my emotions or let them out so after a while I start to break down.Overcome: I plan to start releasing my emotion in some way that will benefit me. Spiritual Me: Strength: I believe in God. I grew up in a strong Christian family. With God Eve always been able to do anything. The Future: Through my faith and knowing that he is God who sent his only begotten son, I know where I'm going when I leave this earth. Challenge: There is always someone who wants to tell me my God is not real and test my faith. Overcome: I will never Judge anyone else or bash what they believe in I will et God do the Judging.Social Me: Strength: I am a very social person and I am not afraid to speak to someone I do not know. The Future: My boss, coworkers, and customers will see that I deal well with communication. Challenge: I don't like to speak to someone who speaks too much. Overcome: I will learn to have patience towards those who speak a lot. Material Me: Strength: If it is not something that I need I will not get it. Materials can wait. The Future: Since I know how to wait on things that catch my eye. I believe if I wait and it comes to me later on, then God blessed me for being patient. Interpersonal Skills Interpersonal skills refer to the skills individuals need when they interact with other people. Also, the meaning of interpersonal skills has a number of synonyms, such as social skills, soft skills, people skills, or communication skills. I chose the pop culture assignment because I like media related information and relating areas of life to it. The clip I chose to present was from the Andy Griffith Show, called â€Å"Citizen’s Arrest. † Some interpersonal communications techniques that are used include kinesics (Wood, 126), paralanguage (Wood, 133), listening for information (Wood, 157), loaded language (Wood, 99) and artifacts (Wood, 129).The most used is paralanguage and kinesics. In this episode of The Andy Griffith Show, Barney is sitting in his police car and sees Gomer Pyle get in his truck after leaving the post office and do an illegal U-turn. Barney proceeds to pull Gomer over and block his truck in. At this point, it is very apparent that Barney is agitated . The nonverbal communication he is using is kinesics. Kinesics is the study of communication through body movements, stances, gestures, or facial expressions (Wood, 126).Kinesics can also be considered body language and eye contact. Our body language signals a great deal about us and how we are feeling at a particular time. Body language and eye contact are key indicators of how we as a society function. Wood states that attorneys have used body language to sway jurors, and customers tip better if their server maintains eye contact during their stay. Throughout the clip, kinesics is frequently used by everyone in the scene from Barney and his agitation, to Gomer being completely confused and later equally agitated.Artifacts are used by everyone â€Å"to announce their identities and to project a particular image to others† (Wood, 129-130). Artifacts are personal objects with which we announce our identities and personalize our environments (Wood, 129). During this clip, Barn ey’s artifact is his police uniform, while Gomer’s artifact is his mechanics uniform. His crooked hat also shows that he perceived as being simple. From the beginning of the clip where Barney pulls Gomer over to the end of the clip, Barney uses paralanguage to communicate.Paralanguage is the way in which you say words, including volume, pitch, speaking rate, and voice quality, as well sounds that are not words. He is talking loudly, or yelling, at Gomer. Paralanguage is also vocal communication that doesn't involve words, such as sounds like gasps and murmurs. Paralanguage is used throughout the clip, by everyone including Barney, Gomer, and the onlookers. When Gomer calls out â€Å"Citizen’s arrest, citizen’s arrest,† after Barney proceeds to do an illegal U-turn, the onlookers cheer for putting Barney is his place.When Andy Griffith comes to find out what is going on, Barney wants to put up a fight about having to write himself a ticket. The onlo okers continue their paralanguage by groaning and murmuring to get Barney to write the ticket. It is at this point that Andy Griffith comes over and starts to listen for information. This is when people want to gain and evaluate information (Wood, 157). He is trying to get to the bottom of all the conflict that is happening in the streets. He is being mindful of both Barney and Gomer by staying focused on the situation and asking questions to get more information.Barney uses loaded language at this point in the clip, as well as one other time later on. He calls Gomer a, â€Å"Boob. † Loaded language refers to language that triggers strong emotional and negative responses (Wood, 99). For example, calling an older person â€Å"geezer† or â€Å"old fogey† is loaded language. During this clip, Barney is speaking emotionally charged words. During this episode of the Andy Griffith show, many styles of verbal and nonverbal communication were used. Kinesics and paralang uage are the most used during the clip.Just watching this episode reminds me that people have many ways to communicate. Although we ought to be setting examples for others to follow, we also need to remember that we ought to treat others as we would like to be treated.Works Cited Wood, J. , Interpersonal Communication: Everyday Encounters, 7th ed. , Published by Wadsworth, Cengage Learning, 2013. â€Å"Citizen’s Arrest,† The Andy Griffith Show. Writ. Everett Greenbaum ;amp; Jim Fritzell. Dir. Dick Crenna. December 16, 1963. http://www. youtube. com/watch? v=rwEvysDpNm0;amp;feature=fvwrel Interpersonal Skills Interpersonal skills refer to the skills individuals need when they interact with other people. Also, the meaning of interpersonal skills has a number of synonyms, such as social skills, soft skills, people skills, or communication skills. I chose the pop culture assignment because I like media related information and relating areas of life to it. The clip I chose to present was from the Andy Griffith Show, called â€Å"Citizen’s Arrest. † Some interpersonal communications techniques that are used include kinesics (Wood, 126), paralanguage (Wood, 133), listening for information (Wood, 157), loaded language (Wood, 99) and artifacts (Wood, 129).The most used is paralanguage and kinesics. In this episode of The Andy Griffith Show, Barney is sitting in his police car and sees Gomer Pyle get in his truck after leaving the post office and do an illegal U-turn. Barney proceeds to pull Gomer over and block his truck in. At this point, it is very apparent that Barney is agitated . The nonverbal communication he is using is kinesics. Kinesics is the study of communication through body movements, stances, gestures, or facial expressions (Wood, 126).Kinesics can also be considered body language and eye contact. Our body language signals a great deal about us and how we are feeling at a particular time. Body language and eye contact are key indicators of how we as a society function. Wood states that attorneys have used body language to sway jurors, and customers tip better if their server maintains eye contact during their stay. Throughout the clip, kinesics is frequently used by everyone in the scene from Barney and his agitation, to Gomer being completely confused and later equally agitated.Artifacts are used by everyone â€Å"to announce their identities and to project a particular image to others† (Wood, 129-130). Artifacts are personal objects with which we announce our identities and personalize our environments (Wood, 129). During this clip, Barn ey’s artifact is his police uniform, while Gomer’s artifact is his mechanics uniform. His crooked hat also shows that he perceived as being simple. From the beginning of the clip where Barney pulls Gomer over to the end of the clip, Barney uses paralanguage to communicate.Paralanguage is the way in which you say words, including volume, pitch, speaking rate, and voice quality, as well sounds that are not words. He is talking loudly, or yelling, at Gomer. Paralanguage is also vocal communication that doesn't involve words, such as sounds like gasps and murmurs. Paralanguage is used throughout the clip, by everyone including Barney, Gomer, and the onlookers. When Gomer calls out â€Å"Citizen’s arrest, citizen’s arrest,† after Barney proceeds to do an illegal U-turn, the onlookers cheer for putting Barney is his place.When Andy Griffith comes to find out what is going on, Barney wants to put up a fight about having to write himself a ticket. The onlo okers continue their paralanguage by groaning and murmuring to get Barney to write the ticket. It is at this point that Andy Griffith comes over and starts to listen for information. This is when people want to gain and evaluate information (Wood, 157). He is trying to get to the bottom of all the conflict that is happening in the streets. He is being mindful of both Barney and Gomer by staying focused on the situation and asking questions to get more information.Barney uses loaded language at this point in the clip, as well as one other time later on. He calls Gomer a, â€Å"Boob. † Loaded language refers to language that triggers strong emotional and negative responses (Wood, 99). For example, calling an older person â€Å"geezer† or â€Å"old fogey† is loaded language. During this clip, Barney is speaking emotionally charged words. During this episode of the Andy Griffith show, many styles of verbal and nonverbal communication were used. Kinesics and paralang uage are the most used during the clip.Just watching this episode reminds me that people have many ways to communicate. Although we ought to be setting examples for others to follow, we also need to remember that we ought to treat others as we would like to be treated.Works Cited Wood, J. , Interpersonal Communication: Everyday Encounters, 7th ed. , Published by Wadsworth, Cengage Learning, 2013. â€Å"Citizen’s Arrest,† The Andy Griffith Show. Writ. Everett Greenbaum ;amp; Jim Fritzell. Dir. Dick Crenna. December 16, 1963. http://www. youtube. com/watch? v=rwEvysDpNm0;amp;feature=fvwrel Interpersonal Skills Interpersonal skills refer to the skills individuals need when they interact with other people. Also, the meaning of interpersonal skills has a number of synonyms, such as social skills, soft skills, people skills, or communication skills. I chose the pop culture assignment because I like media related information and relating areas of life to it. The clip I chose to present was from the Andy Griffith Show, called â€Å"Citizen’s Arrest. † Some interpersonal communications techniques that are used include kinesics (Wood, 126), paralanguage (Wood, 133), listening for information (Wood, 157), loaded language (Wood, 99) and artifacts (Wood, 129).The most used is paralanguage and kinesics. In this episode of The Andy Griffith Show, Barney is sitting in his police car and sees Gomer Pyle get in his truck after leaving the post office and do an illegal U-turn. Barney proceeds to pull Gomer over and block his truck in. At this point, it is very apparent that Barney is agitated . The nonverbal communication he is using is kinesics. Kinesics is the study of communication through body movements, stances, gestures, or facial expressions (Wood, 126).Kinesics can also be considered body language and eye contact. Our body language signals a great deal about us and how we are feeling at a particular time. Body language and eye contact are key indicators of how we as a society function. Wood states that attorneys have used body language to sway jurors, and customers tip better if their server maintains eye contact during their stay. Throughout the clip, kinesics is frequently used by everyone in the scene from Barney and his agitation, to Gomer being completely confused and later equally agitated.Artifacts are used by everyone â€Å"to announce their identities and to project a particular image to others† (Wood, 129-130). Artifacts are personal objects with which we announce our identities and personalize our environments (Wood, 129). During this clip, Barn ey’s artifact is his police uniform, while Gomer’s artifact is his mechanics uniform. His crooked hat also shows that he perceived as being simple. From the beginning of the clip where Barney pulls Gomer over to the end of the clip, Barney uses paralanguage to communicate.Paralanguage is the way in which you say words, including volume, pitch, speaking rate, and voice quality, as well sounds that are not words. He is talking loudly, or yelling, at Gomer. Paralanguage is also vocal communication that doesn't involve words, such as sounds like gasps and murmurs. Paralanguage is used throughout the clip, by everyone including Barney, Gomer, and the onlookers. When Gomer calls out â€Å"Citizen’s arrest, citizen’s arrest,† after Barney proceeds to do an illegal U-turn, the onlookers cheer for putting Barney is his place.When Andy Griffith comes to find out what is going on, Barney wants to put up a fight about having to write himself a ticket. The onlo okers continue their paralanguage by groaning and murmuring to get Barney to write the ticket. It is at this point that Andy Griffith comes over and starts to listen for information. This is when people want to gain and evaluate information (Wood, 157). He is trying to get to the bottom of all the conflict that is happening in the streets. He is being mindful of both Barney and Gomer by staying focused on the situation and asking questions to get more information.Barney uses loaded language at this point in the clip, as well as one other time later on. He calls Gomer a, â€Å"Boob. † Loaded language refers to language that triggers strong emotional and negative responses (Wood, 99). For example, calling an older person â€Å"geezer† or â€Å"old fogey† is loaded language. During this clip, Barney is speaking emotionally charged words. During this episode of the Andy Griffith show, many styles of verbal and nonverbal communication were used. Kinesics and paralang uage are the most used during the clip.Just watching this episode reminds me that people have many ways to communicate. Although we ought to be setting examples for others to follow, we also need to remember that we ought to treat others as we would like to be treated.Works Cited Wood, J. , Interpersonal Communication: Everyday Encounters, 7th ed. , Published by Wadsworth, Cengage Learning, 2013. â€Å"Citizen’s Arrest,† The Andy Griffith Show. Writ. Everett Greenbaum ;amp; Jim Fritzell. Dir. Dick Crenna. December 16, 1963. http://www. youtube. com/watch? v=rwEvysDpNm0;amp;feature=fvwrel